breakfast of champions

Joined

• started 139 topics
• posted 5,192 times   see topics posted on
• send a message

Posts by breakfast of champions

• 
  44

  Honeymoon over for the carts

  by Deltawave in

  1. watchtower
  2. beliefs

  speaking with inlaws i another congregation today who said exactly what is being said in our own hall.

  the trolly work is long and boring and no one even notices they are there anymore but walk right on by.

  jehovah really is speeding up the work lol.

  1. 
  2. 
  3. 
• 

  breakfast of champions

  They're going to have to build some kind of hot coffee dispenser off the back of those things.
• 
  52

  The Deep Things of Jehovah(tm). What are they?

  by punkofnice in

  1. watchtower
  2. bible

  i just wondered.

  .

  1. 
  2. 
  3. 
• 

  breakfast of champions

  I agree with everything above.

  Personally, I think it's part of the whole thought reform/brainwashing technique.

  Telling someone that they can't understand something (in this case, pure bullshit) because it's too "deep" for them to understand is really just a subtle way to disparage or attack a person's built-in critical thinking machinery. You don't understand this? Well, there must be something deficient with YOU. No possiblility that this is just total crap and that's why it's incomprehensible.

  It's actually a liberating feeling when you realize that, if you put in the time and effort, you CAN actually understand some truly deep ideas (physics, biology, philosophy, whatever interests you.) Yeah, maybe you'll never know everything, but you can sure as hell rule out garbage like the stuff WT spews out there.
• 
  13

  Snow fall in Jan 2015

  by Lostandfound in

  1. jw
  2. friends

  will the expected heavy snow isolate warwick ny, or brooklyn.

  i hope the snow traps the gb showing clearly jehovah's favour and blessing.

  1. 
  2. 
  3. 
• 

  breakfast of champions

  Doesn't look like it. Looks like the worst will be further south, Philly and that area.

  So much for my career in meteorology. . . .

  It's already up to my knees out there and there's no sign of it slowing down.
• 
  3

  Evolution is a Fact #8 - Jumping Genes

  by cofty in

  1. watchtower
  2. beliefs

  we have all become familiar with the use of dna in forensics and paternity disputes.

  all humans share 99.9% of their genome in common, but that still leaves plenty room for variation.. geneticists are able to study sections of dna that identify an individual and their closest relatives.

  mostly these genetic markers are found in our non-coding dna such as the sections of code known as transposons.. one type of transposon is known as the alu element.

  1. 
  2. 
  3. 
• 

  breakfast of champions

  So .. . . . thanks to COFTY'S "Fact #8" post, we have all learned that Jehovah threw some ALU's in our DNA to PROVE that he knew how to cut-and-paste before any of us poor bastards did.

  What COFTY failed to point out is that Jehovah also used "emojis" well before humans did. Consider the gene that codes for STUPID_BLANK_STARE:

  ATTTAGCCCGGATTTAGCCCGGATA : | ATTAGCCGATCGATGATCGAC

  The evidence for God is literally staring you in the face.
• 
  49

  "If I wasn't born a JW, I would never have become one."

  by OneEyedJoe in

  1. jw
  2. experiences

  i've seen it mentioned by a few on the forum that at some point there was a realization that had they not been born a jw, they never would've converted no matter how many times the jws tried to study with them.

  this was my experience too, and i'm wondering how universal it is for those that were born-in but eventually left.

  i think i started having this thought (more specifically that if i were not born a jw, i would surely have become an atheist by now) in my late teens.

  1. 
  2. 
  3. 
• 

  breakfast of champions

  No way in hell.
• 
  10

  Evolution, Critical Thinking, and Other Things the JWs Never Told Me

  by David_Jay in

  1. watchtower
  2. beliefs

  after reading several threads on the topics of evolution and theism, i thought i would share what happens to you when you go to college and get a real education on things: you learn that some of the arguments and stands of jehovah's witnesses are moot to begin with.

  i never double-checked the "modus operandi" about many things, and boy, did i have some real learning to do.. for instance, why are jehovah's witnesses so against evolution?

  it only proves their point.

  1. 
  2. 
  3. 
• 

  breakfast of champions

  Great post DAVID JAY!

  Welcome.
• 
  28

  Satanic Temple’s Seven Tenets - Makes 10 Commandments Sound Facile

  by cofty in

  1. watchtower
  2. beliefs

  the so-called 10 commandments are a post-biblical construct.... there is an elohist list at exodus 20 and a yahwist one at exodus 34 that contains such gems as "you shall not cook a kid in its mother’s milk.".

  any intelligent adult could create a more useful list of ethical precepts before the end of a coffee break.. it is interesting to compare the satanic temple's seven tenets.

  i think you might agree that it makes yahweh's rules look like they were written by a bronze age power-hungry, misogynistic priest.

  1. 
  2. 
  3. 
• 

  breakfast of champions

  No wonder this world is such a mess . . . . everyone must be applying these dreadful, Satanic principles in their lives . . . . .
• 
  13

  Snow fall in Jan 2015

  by Lostandfound in

  1. jw
  2. friends

  will the expected heavy snow isolate warwick ny, or brooklyn.

  i hope the snow traps the gb showing clearly jehovah's favour and blessing.

  1. 
  2. 
  3. 
• 

  breakfast of champions

  Will the expected heavy snow isolate Warwick NY, or Brooklyn

  Doesn't look like it. Looks like the worst will be further south, Philly and that area.
• 
  31

  Evolution is a Fact #5 - Vitamin C

  by cofty in

  1. watchtower
  2. beliefs

  part 1 - protein functional redundancypart 2 - dna functional redundancypart 3 - ervspart 4 - smelly genes.

  in part 4 we saw that roughly half of the 800 genes in the human genome that code for olfactory receptors are broken remnants of our evolutionary history.

  they were vital to our distant ancestors but in humans, as in our primate cousins they have been allowed to fall into disuse as our eyes became more important to our survival than our nose.

  1. 
  2. 
  3. 
• 

  breakfast of champions

  This is really interesting. . . .

  Next time my wife tries to force vitamin C pills on me, I'll tell her Jehovah's to blame for breaking my GLUO.
• 
  43

  Evolution is a Fact #3 - ERVs

  by cofty in

  1. watchtower
  2. beliefs

  part 1 - protein functional redundancy.... part 2 - dna functional redundancy.... imagine you are teacher with suspicions that some of your pupils have been copying from each other.

  comparing the correct answers in all of their assignments might not provide conclusive evidence.

  they could simply claim they had all carefully revised the same textbooks so it shouldn't be surprising that they all gave the same answers.

  1. 
  2. 
  3. 
• 

  breakfast of champions

  Remember when you were a little dub and you would litter the world with your watchtower magazines thinking you making a difference. Your daily DAVID BOWIE THREADS ARE becoming quite redundant complete with the same arrogance of most relentless uber pioneer.

  If anyone is truly interested in DAVID BOWIE, GO TO your local RECORD STORE or WATCH A CONCERT VIDEO ON YOUTUBE because this is all becoming quite annoying.